DNA profiling

DNA profiling is the process where a specific DNA pattern, called a profile, is obtained from a person or sample of bodily tissue . Even though we are all unique, most of our DNA is actually identical to other people’s DNA. However, specific regions vary highly between people. These regions are called polymorphic. Differences in these variable regions between people are known as polymorphisms. Each of us inherits a unique combination of polymorphisms from our parents. DNA polymorphisms can be analysed to give a DNA profile.

Human DNA profiles can be used to identify the origin of a DNA sample at a crime scene or test for parentage.

DNA profiling is used to:

  • identify the probable origin of a body fluid sample associated with a crime or crime scene
  • reveal family relationships
  • Identify the gender
  • identify disaster victims, for example, ESR scientists travelled to Thailand to help identify victims of the 2004 Boxing Day tsunami.

What are short tandem repeats?

One of the current techniquesfor DNA profiling uses polymorphisms called short tandem repeats. Short tandem repeats (or STRs) are regions of non-coding DNA that contain repeats of the same nucleotide sequence.

For example, GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA is repeated six times.

STRs are found at different places or genetic loci in a person’s DNA.

What is a DNA profile?

One way to produce a DNA profile, is for scientists to examine STRs at 10 or more genetic loci. These genetic loci are usually on different chromosomes. A DNA profile can tell the scientist if the DNA is from a man or woman, and if the sample being tested belongs to a particular person.

Chromosomes
DNA profiling examines sites on several chromosomes.

How do you create a DNA profile using STR?

1. Get a sample of DNA

DNA is found in most cells of the body, including white blood cells, semen, hair roots and body tissue. Traces of DNA can also be detected in body fluids, such as saliva and perspiration because they also contain epithelial cells. Forensic scientists and Police officers collect samples of DNA from crime scenes. DNA can also be collected directly from a person using a mouth swab (which collects inner cheek cells).

2. Extract the DNA

DNA is contained within the nucleus of cells. Chemicals are added to break open the cells, extract the DNA and isolate it from other cell components.

3. Copy the DNA

Often only small amounts of DNA are available for forensic analysis so the STRs at each genetic locus are copied many times using the polymerase chain reaction (PCR) to get enough DNA to make a profile. Specific primers are used during PCR that attach a fluorescent tag to the copied STRs.

4. Determine the size of the STRs

The size of the STRs at each genetic locus is determined using a genetic analyser. The genetic analyser separates the copied DNA by gel electrophoresis and can detect the fluorescent dye on each STR. This is the same piece of equipment used in the lab for DNA sequencing.

5. Is there a match?

The number of times a nucleotide sequence is repeated in each STR can be calculated from the size of the STRs. A forensic scientist can use this information to determine if a body fluid sample comes from a particular person.

If two DNA profiles from different samples are the same, the chance that the samples came from different people is low. This provides strong evidence that the samples have a common source.To produce a DNA profile, scientists examine STRs at ten, or more, genetic loci. These genetic loci are usually on different chromosomes.

Scroll to Top